SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g17080

Feature Type:gene_model
Chromosome:Gm08
Start:12505844
stop:12511577
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g17080
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G65930AT Annotation by Michelle Graham. TAIR10: cytosolic NADP+-dependent isocitrate dehydrogenase | chr1:24539088-24541861 FORWARD LENGTH=410 SoyBaseE_val: 0ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006102GO-bp Annotation by Michelle Graham. GO Biological Process: isocitrate metabolic process SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006739GO-bp Annotation by Michelle Graham. GO Biological Process: NADP metabolic process SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0010043GO-bp Annotation by Michelle Graham. GO Biological Process: response to zinc ion SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0051049GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transport SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000287GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding SoyBaseN/AISS
GO:0004450GO-mf Annotation by Michelle Graham. GO Molecular Function: isocitrate dehydrogenase (NADP+) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG1526 KOG NADP-dependent isocitrate dehydrogenase JGI ISS
PTHR11822Panther NADP-SPECIFIC ISOCITRATE DEHYDROGENASE JGI ISS
PF00180PFAM Isocitrate/isopropylmalate dehydrogenase JGI ISS
UniRef100_I1KTT3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Isocitrate dehydrogenase [NADP] n=1 Tax=Glycine max RepID=I1KTT3_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1KTT3UniRef Annotation by Michelle Graham. Best UniRef hit: Isocitrate dehydrogenase [NADP] n=1 Tax=Glycine max RepID=I1KTT3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g17080
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g17080
ParalogEvidenceComments
Glyma15g42100 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g17080 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g160500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g17080
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g17080
>Glyma08g17080.1   sequence type=CDS   gene model=Glyma08g17080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTTTCAGAAGATAAGGGTGGGCAACCCCATCGTCGAAATGGATGGGGATGAAATGACCCGAGTGATTTGGAAACTGATAAAAGATAAGCTTATTTTCCCTTATTTGGAGCTGGATATTAAGTATTTTGACCTTGGCCTTCCTCATCGCGATGCCACTAATGATAGAGTTACTATTGAAAGCGCTGAAGCTACACTCAAGTATAATGTAGCTATCAAATGTGCTACTATAACTCCAGATGAAGCTCGTGTCAAGGAGTTTAACTTAAAACAAATGTGGAGAAGTCCAAATGGGACGATCCGAAACATTTTAAATGGTACAGTTTTTAGAGAGCCAATTATCTGTAAGAACATTCCTCGTCTTGTTTCAGGATGGACAAAGCCAATATGCATTGGAAGACATGCTTTTGGAGACCAATATCGGGCAACTGATACAGTTATAAAAGGCCCAGGAAAGCTAAAATTGGTTTTTGCACCCAGTGGAAATGAAGGCATTAAAGAGCTAGAGGTCTATAACTTTACTGGTGCTGGAGGCATAGCTTTGTCCATGTATAATACTGATGAGTCCATTCGAGCTTTTGCTGAGGCTTCAATGAACTTTGCTTACCAGAAGAAATGGCCTCTCTATCTTAGCACTAAAAATACCATTTTAAAGAAATATGATGGAAGATTCAAGGACATTTTCCAGGAAGTTTTTGACACCCAATGGAATCACAAGTTCAAAGCTGCAGGGATATGGTATGAACACCGTCTTATAGATGATATGGTTGCTTATGCTCTCAAAAGTGATGGAGGTTATGTATGGGCCTGCAAGAATTATGATGGTGATGTGCAGAGTGATTTCTTAGCTCAAGGATTTGGTTCACTTGGCTTGATGACGTCAGTACTGGTTTGCCCAGATGGGAAAACCATTGAAGCAGAGGCAGCCCATGGCACTGTTACCCGTCATTATCGGGTTCATCAGAAGGGAGGTGAAACCAGCACAAACAGTATTGCTTCAATTTTTGCCTGGTCGCGAGGTCTTGCACATAGGGCAAAATTGGATGGAAATGCTAGATTGTTGGACTTCACAGAGAAACTGGAAGCAGCTTGCATTGGAACAGTTGAATTGGGAAAGATGACAAAGGATCTTGCACTTCTTGTTCATGGACCTAAGGTTTCTAGATCCCAGTATTTGAATACTGAAGAGTTCATTGATGCCGTAGCCGAGGAGCTGCGAACAAGATTATCTTCACAATCGAAGCTGTAA
Predicted protein sequences of Glyma08g17080
>Glyma08g17080.1   sequence type=predicted peptide   gene model=Glyma08g17080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGFQKIRVGNPIVEMDGDEMTRVIWKLIKDKLIFPYLELDIKYFDLGLPHRDATNDRVTIESAEATLKYNVAIKCATITPDEARVKEFNLKQMWRSPNGTIRNILNGTVFREPIICKNIPRLVSGWTKPICIGRHAFGDQYRATDTVIKGPGKLKLVFAPSGNEGIKELEVYNFTGAGGIALSMYNTDESIRAFAEASMNFAYQKKWPLYLSTKNTILKKYDGRFKDIFQEVFDTQWNHKFKAAGIWYEHRLIDDMVAYALKSDGGYVWACKNYDGDVQSDFLAQGFGSLGLMTSVLVCPDGKTIEAEAAHGTVTRHYRVHQKGGETSTNSIASIFAWSRGLAHRAKLDGNARLLDFTEKLEAACIGTVELGKMTKDLALLVHGPKVSRSQYLNTEEFIDAVAEELRTRLSSQSKL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo